Skip to content

My Account

Search

My Library

Help

     
Result: Previous Next
Start Over Save this record Return to Browse Limit or Sort these search results Another search of the same type
Author Gibson, William, 1948-
Uniform Title Agrippa
Title AATCATACGAGTTTGCATAACTGAATTGGT
Imprint [New York, NY : Kevin Begos Publishing, c1992]
Location Call No. Status Help Message
 Schwarzman Building (42nd Street & 5th Avenue) - Rare Book Collection  *KP+++ (Sun Hill) 05-60    AVAILABLE PERMIT NEEDED

Details

Description [100] p. : ill. ; 41 cm. + 1 computer disk (3 3/4 in.)
Note 95 copies printed.
Poem by William Gibson, etchings by Dennis Ashbaugh.
"The deluxe edition of Agrippa was set in Monotype Gill Sans at Golgonooza Letter Foundry, and printed on Rives heavyweight text by the Sun Hill Press and by Kevin Begos Jr. The etchings were made by the artist and editioned by Peter Pettingill on Fabriano Tiepolo paper. The book was handsewn and bound in linen by Karl Foulkes. The housing was designed by the artist, and the encryption code used to destroy the story was created by (BRASH), with help from several other individuals"--Center for Book Arts website, viewed 3/23/05: URL=http://www.centerforbookarts.org/archive/showdetail.asp?showID=62
Form The poem is published in its entirety in unencrypted form on the author's website and elsewhere on the Internet.
Note Imprint information taken from Internet editions of the poem, e.g. the TOTSE website, viewed 3/23/05: URL=http://www.totse.com/en/ego/science%5Ffiction/agrippa.html
The ill. are etchings (8 full-page, 1 superimposed on the text), from images incorporating depictions of nucleic acids in green or brown with superimposed imagery from old advertisements. There are two photosensitive images that appear or disappear when exposed to light.
Final 20 leaves glued together, with cut-out recess enclosing a 3-1/2 in. floppy disk containing the poem, which may be displayed on a computer screen only once, and then is irretrievably encrypted. Once the program on the disk has begun displaying the poem, it cannot be stopped, copied, or printed.
Binding: Publisher's natural distressed linen boards, with title stamped in brown on front cover, by Karl Foulkes. Issued in a dark brown translucent case (59 x 39 x 8 cm.) composed of resin-impregnated paper and fiberglass, designed by the artist. Top of case lifts off to reveal honeycomb cardboard cutout covered in copper glitter with recess to contain the book, which is partly wrapped in a shroud of cloth netting.
Local Note NYPL has no. 12/95; signed by the author and the artist.
Language Text in book consists of permutations of the letter string C-A-T-G, the symbols for the four bases, cytosine, adenine, thymine, and guanine, that make up the genetic code. Printed in double columns.
Subject Memory -- Poetry.
DNA in art.
Ashbaugh, Dennis, 1946-
Artists' books.
Genre/Form Artists' books -- United States.
Typefaces (Type evidence) -- Gill Sans. (Monotype).
Artists' books.
Added Author Ashbaugh, Dennis, 1946- Illustrator, Etcher.
Begos, Kevin, Publisher, Printer.
Pettingill, Peter, printer of plates.
Foulkes, Karl, Binder.
Sun Hill Press, Printer.
Golgonooza Letter Foundry, Compositor.
Note Cover title: Agrippa : a book of the dead
Added Title AATCA TACGA GTTTG CATAA CTGAA TTGGT
Call No. *KP+++ (Sun Hill) 05-60
Research Call Number *KP+++ (Sun Hill) 05-60