Research Catalog
New! Try our Article Search to discover online journals, books, and more from home with your library card.
Displaying 1-50 of 177 results for keywords "DNA in art."
DNA : Han'guk misul ŏje wa onŭl = DNA : dynamic & alive Korean art.
- Text
- Sŏul T'ŭkpyŏlsi : Kungnip Hyŏndae Misulgwan, 2021.
- 2021
- 1 Item
Item details Format Call Number Item Location Text N7362 .D53 2021 Off-site The strands of a life : the science of DNA and the art of education / Robert L. Sinsheimer.
- Text
- 1994
- 1 Item
Item details Format Call Number Item Location Text QH31.S573 A3 1994 Off-site The strands of a life : the science of DNA and the art of education / Robert L. Sinsheimer.
- Text
- Berkeley : University of California Press, c1994.
- 1994
- 1 Item
Available Online
http://ark.cdlib.org/ark:/13030/ft5j49p04rItem details Format Call Number Item Location Text JSE 13-381 Offsite The strands of a life : the science of DNA and the art of education / Robert L. Sinsheimer.
- Text
- Berkeley : University of California, [1994], ©1994.
- 1994-1994
- 1 Item
Item details Format Call Number Item Location Text QH31.S573 A3 1994 Off-site The strands of a life : the science of DNA and the art of education / Robert L. Sinsheimer.
- Text
- Berkeley : University of California Press, ©1994.
- 1994
- 1 Item
Item details Format Call Number Item Location Text QH31.S573 A3 1994 Off-site McArthur Binion : DNA / edited by Diana Nawi ; with contributions by Grace Deveney, Franklin Sirmans, and Michael Stone-Richards.
- Text
- New York, New York : DelMonico Books, 2021.
- 2021-2021
- 1 Item
Item details Format Call Number Item Location Text N6537.B533 A4 2021 Off-site DNA deli coffee cups / featuring Roz Chast, Maira Kalman, Cary Leibowitz/Candyass, Larry Miller, Tom Tomorrow.
- Text
- New York, N.Y. : Creative Time, 2000.
- 1 Item
Item details Format Call Number Item Location Text MEMZ (Creative Time) 09-1157 Schwarzman Building - Print Collection Room 308 Available - Can be used on site. Please visit New York Public Library - Schwarzman Building to submit a request in person.
McArthur Binion : DNA / edited by Diana Nawi ; with contributions by Grace Deveney, Franklin Sirmans, and Michael Stone-Richards.
- Text
- New York, New York : DelMonico Books, 2021.
- 2021-2021
- 1 Item
Item details Format Call Number Item Location Text JQG 21-366 Schwarzman Building M1 - Art & Architecture Room 300 Available - Can be used on site. Please visit New York Public Library - Schwarzman Building M1 to submit a request in person.
Understanding DNA ancestry / Sheldon Krimsky.
- Text
- Cambridge : Cambridge University Press, 2022.
- 2022-2022
- 1 Item
Item details Format Call Number Item Location Text JFC 22-168 Schwarzman Building - Main Reading Room 315 Available - Can be used on site. Please visit New York Public Library - Schwarzman Building to submit a request in person.
The evaluation of forensic DNA evidence / Committee on DNA Forensic Science: an Update, Commission on DNA Forensic Science: an Update, National Research Council.
- Text
- Washington, D.C. : National Academy Press, 1996.
- 1996
- 1 Item
Item details Format Call Number Item Location Text RA1057.5 .E94 1996 Off-site DNA methylation : approaches, methods, and applications / edited by Manel Esteller.
- Text
- Boca Raton : CRC Press, [2005], ©2005.
- 2005-2005
- 1 Item
Item details Format Call Number Item Location Text QP624.5.M46 D626 2005 Off-site Classic contemporary : the DNA of furniture design / Tim Gosling.
- Text
- [London] : Thames & Hudson, 2015.
- 2015
- 1 Item
Item details Format Call Number Item Location Text JQG 16-240 Schwarzman Building M1 - Art & Architecture Room 300 Available - Can be used on site. Please visit New York Public Library - Schwarzman Building M1 to submit a request in person.
Vremeni chasha bez dna : stikhotvorenii︠a︡,1969-1991.
- Text
- [Philadelphia?] : Contemporary Russian Art Center of America, 1992.
- 1992
- 1 Item
Item details Format Call Number Item Location Text PG3485.5.A377 V7 1992g Off-site Vremeni chasha bez dna : stikhotvoreni︠i︡a, 1969-1991 / Vitaliĭ Rakhman.
- Text
- [Philadelphia?] : Contemporary Russian Art Center of America, 1992.
- 1992
- 1 Item
Item details Format Call Number Item Location Text *QDH 93-5896 Schwarzman Building M2 - General Research Room 315 Available - Can be used on site. Please visit New York Public Library - Schwarzman Building M2 to submit a request in person.
Ŏrin ai Han'gugin : kŭlssi esŏ ch'ajŭn Han'gugin ŭi DNA / Ku Pon-jin.
- Text
- Kyŏnggi-do P'aju-si : Kimyŏngsa, 2015.
- 2015
- 1 Item
Available Online
http://catdir.loc.gov/catdir/toc/fy15pdf02/2015432347.htmlItem details Format Call Number Item Location Text BF898.K6 K83 2015 Off-site The new Florence Biennale : ethics DNA of art : Biennale internazionale d'arte contemporanea di Firenze, 2013, IX edizione.
- Text
- Bologna : Logo Fausto Lupetti, c2013.
- 2013
- 1 Item
Item details Format Call Number Item Location Text JQE 14-112 Schwarzman Building M1 - Art & Architecture Room 300 Available - Can be used on site. Please visit New York Public Library - Schwarzman Building M1 to submit a request in person.
Democracy and DNA : American dreams and medical progress / Gerald Weissmann.
- Text
- New York : Hill and Wang, 1995.
- 1995
- 1 Item
Item details Format Call Number Item Location Text R152 .W46 1995 Off-site Design and analysis of DNA microarray investigations / Richard M. Simon ... [et al.].
- Text
- 2003
- 1 Item
Item details Format Call Number Item Location Text QP624.5.D726 D475 2003 Off-site Vremeni chasha bez dna : stikhotvoreniia 1969-1991 / Vitalii Rakhman.
- Text
- [East Long Meadow, Ma.] : Contemporary Russian Art Center of America : The Cremona Foundation, Inc.: Printed by Selecom Pub. Inc. 1992.
- 1992
- 1 Item
Item details Format Call Number Item Location Text PG3485.5.A377 V74 1992 Off-site Klaus U. Hilsbecher : DNA signature : 20.5.2017-12.11.2017, Núcleo de Arte Contemporânea do Museu do Vidro, Marinha Grande, Portugal / [Kurator, Redaktion: Klaus U. Hilsbecher].
- Text
- Berlin : Edition Braus Berlin, 2017.
- 2017
- 1 Item
Item details Format Call Number Item Location Text JQF 19-883 Schwarzman Building M1 - Art & Architecture Room 300 Available - Can be used on site. Please visit New York Public Library - Schwarzman Building M1 to submit a request in person.
June Wayne's narrative tapestries : tidal waves, DNA, and the cosmos / Christa C. Mayer-Thurman.
- Text
- 2010
- 1 Item
Item details Format Call Number Item Location Text ND237.W27 A4 2010g Off-site Blood evidence : how DNA is revolutionizing the way we solve crimes / Henry C. Lee, Frank Tirnady.
- Text
- Cambridge, MA : Perseus Pub., c2003.
- 2003
- 1 Item
Item details Format Call Number Item Location Text RA1057.55 .L44 2003 Off-site Tissues, cultures, art / Ionat Zurr, Oron Catts.
- Text
- Cham, Switzerland : Palgrave Macmillan, [2023]
- 2023-2023
- 1 Item
Item details Format Call Number Item Location Text JQD-23-334 Schwarzman Building M2 - Art and Architecture Room 300 Available - Can be used on site. Please visit New York Public Library - Schwarzman Building M2 to submit a request in person.
The art of plant evolution / W. John Kress and Shirley Sherwood.
- Text
- Richmond : Kew Pub., 2009.
- 2009
- 1 Item
Item details Format Call Number Item Location Text JSF 13-349 Offsite Me, according to the history of art / Dick Frizzell.
- Text
- Auckland, New Zealand : Massey University Press, 2020.
- 2020-2020
- 1 Item
Item details Format Call Number Item Location Text JQF 21-685 Schwarzman Building M1 - Art & Architecture Room 300 Available - Can be used on site. Please visit New York Public Library - Schwarzman Building M1 to submit a request in person.
Intersezioni 5 : Michelangelo Pistoletto, il DNA del terzo Paradiso al Parco archeologico di Scolacium e al MARCA / a cura di Alberto Fiz.
- Text
- 2010
- 1 Item
Item details Format Call Number Item Location Text N6923.P5 A4 2010 Off-site Trakams 700 : tapatybės beieškant : trakiečio DNR : ex libris tarptautinis konkursas = Trakai 700 : in search of identity : Trakai resident's DNA : ex libris international competition.
- Text
- Trakai : Trakų istorijos muziejus, 2021.
- 2021
A book of reading in Arts and Social Sciences.
- Text
- Yola : School of Arts and Social Sciences, Federal College of Education, 2015.
- 1 Item
Item details Format Call Number Item Location Text H53.N6 F43 2015 Off-site A book of reading in Arts and Social Sciences.
- Text
- Yola : School of Arts and Social Sciences, Federal College of Education, 2015.
- 2015
- 1 Item
Item details Format Call Number Item Location Text ReCAP 18-5413 Offsite Modern analytical methods in art and archaeology / E. Ciliberto and G. Spoto, editors.
- Text
- New York : Wiley, 2000.
- 2000
- 1 Item
Item details Format Call Number Item Location Text N8558 .M63 2000 Off-site Kindred : Neanderthal life, love, death and art / Rebecca Wragg Sykes.
- Text
- London ; Oxford ; New York : Bloomsbury Sigma, 2020.
- 2020
- 1 Item
Item details Format Call Number Item Location Text JFE 21-3773 Schwarzman Building - Main Reading Room 315 Available - Can be used on site. Please visit New York Public Library - Schwarzman Building to submit a request in person.
The inaugural exhibitions of the Harvey B. Gantt Center for African-American Arts + Culture.
- Text
- Charlotte, N.C. : The Center, c2009.
- 2009
- 1 Item
Item details Format Call Number Item Location Text Sc+ E 11-1072 Schomburg Center - Research & Reference Available - Can be used on site. Please visit New York Public Library - Schomburg Center to submit a request in person.
Me, according to the history of art / Dick Frizzell.
- Text
- Auckland, New Zealand : Massey University Press, 2020.
- 2020-2020
- 1 Item
Item details Format Call Number Item Location Text N5300 .F645 2020 Off-site Egyptian mummies : unraveling the secrets of an ancient art / Bob Brier.
- Text
- 1994
- 1 Item
Item details Format Call Number Item Location Text DT62.M7 B67 1994 Off-site The molecular gaze : art in the genetic age / Suzanne Anker, Dorothy Nelkin.
- Text
- Cold Spring Harbor, N.Y. : Cold Spring Harbor Laboratory Press, c2004.
- 2004
- 1 Item
Item details Format Call Number Item Location Text N72.S3 A53 2004 Off-site Genes and jazz [videorecording] : Works & process at the Guggenheim / [performance series producer, Mary Sharp Cronson].
- Moving image
- 2008.
- 2008-1116
- 1 Item
Item details Format Call Number Item Location Moving image *MGZIDVD 5-4480 Performing Arts Research Collections - Dance Available - Can be used on site. Please visit New York Public Library - Performing Arts Research Collections to submit a request in person.
Genes and jazz [videorecording] : Works & process at the Guggenheim / [performance series producer, Mary Sharp Cronson].
- Moving image
- 2008.
- 2008-1117
- 1 Item
Item details Format Call Number Item Location Moving image *MGZIDVD 5-4484 Performing Arts Research Collections - Dance Available - Can be used on site. Please visit New York Public Library - Performing Arts Research Collections to submit a request in person.
Ancestors : a project of the Boston Review Arts in Society Program / guest edited by Alexis Pauline Gumbs, Ed Pavlić, & Ivelisse Rodriguez.
- Text
- Cambridge, MA : Boston Review, [2021]
- 2021
- 2 Items
Item details Format Call Number Item Location Text JFE 21-7543 Schwarzman Building - Main Reading Room 315 Available - Can be used on site. Please visit New York Public Library - Schwarzman Building to submit a request in person.
Item details Format Call Number Item Location Text Sc D 22-833 Schomburg Center - Research & Reference Available - Can be used on site. Please visit New York Public Library - Schomburg Center to submit a request in person.
Sequencia [sound recording] / Susan Alexjander.
- Audio
- Berkeley, CA : Science & the Arts, p1994.
- 1994-1990
- 1 Item
Item details Format Call Number Item Location Audio M1473.A44 S47 1994g Off-site The art of plant evolution / W. John Kress and Shirley Sherwood.
- Text
- Richmond, Surrey, U.K. : Kew Publishing, 2009.
- 2009
- 1 Item
Item details Format Call Number Item Location Text Off-site The arts of the microbial world [electronic resource] : fermentation science in twentieth-century Japan / Victoria Lee.
- Text
- Chicago : The University of Chicago Press, 2021.
- 2021
- 1 Resource
Available Online
http://WU9FB9WH4A.search.serialssolutions.com/?V=1.0&L=WU9FB9WH4A&S=JCs&C=TC0002515914&T=marc&tab=BOOKSOvarian cancer : state of the art and future directions in translational research / George Coukos, Andrew Berchuck, Robert Ozols, editors.
- Text
- New York, NY : Springer, [2008], ©2008.
- 2008-2008
- 1 Item
Item details Format Call Number Item Location Text RC280.O8 O96 2008 Off-site Methods of microarray data analysis IV / edited by Jennifer S. Shoemaker, Simon M. Lin.
- Text
- 2005
- 1 Item
Item details Format Call Number Item Location Text QP624.5.D726 M483 2005 Off-site Lynn Hershman Leeson : Twisted / edited by Margot Norton
- Text
- New York : New Museum of Contemporary Art, 2021
- 2021
- 1 Item
Item details Format Call Number Item Location Text N6537.H398 A4 2021g Off-site Science and the quiet art : the role of medical research in health care / David Weatherall.
- Text
- 1995
- 1 Item
Item details Format Call Number Item Location Text R723 .W355 1995 Off-site Science and the quiet art : the role of medical research in health care / David Weatherall.
- Text
- New York : W.W. Norton, [1995], ©1995.
- 1995-1995
- 1 Item
Item details Format Call Number Item Location Text R723 .W355 1995 Off-site AATCATACGAGTTTGCATAACTGAATTGGT
- Text
- [New York, NY : Kevin Begos Publishing, c1992]
- 1992
- 1 Item
Item details Format Call Number Item Location Text *KP+++ (Sun Hill) 05-60 Schwarzman Building - Rare Book Collection Room 328 Available - Can be used on site. Please visit New York Public Library - Schwarzman Building to submit a request in person.
Martin Sikora / Eske Willerslev : DNArt / redaktion: Christiane Finsen, Inge Merete Kjeldgaard.
- Text
- Esbjerg : Esbjerg Kunstmuseum, [2021]
- 2021
- 1 Item
Item details Format Call Number Item Location Text JQF 22-877 Schwarzman Building M1 - Art & Architecture Room 300 Available - Can be used on site. Please visit New York Public Library - Schwarzman Building M1 to submit a request in person.
Microarray image analysis : an algorithmic approach / Karl Fraser, Zidong Wang, Xiaohui Liu.
- Text
- 2010
- 1 Item
Item details Format Call Number Item Location Text QP624.5.D726 F73 2010 Off-site Code / Charlotte Pence.
- Text
- [New York, New York] : Black Lawrence Press, 2020.
- 2020-2020
- 1 Item
Item details Format Call Number Item Location Text JFD 21-1344 Schwarzman Building - Main Reading Room 315 Available - Can be used on site. Please visit New York Public Library - Schwarzman Building to submit a request in person.
No results found from Digital Research Books Beta
Digital books for research from multiple sources world wide- all free to read, download, and keep. No Library Card is Required. Read more about the project.
